MICROSATELLITE DNA

As demonstrated in this study, 960 foals were qualified by the compatibility of 14 markers according to Mendelian fashion in the present DNA typing for parentage verification. However, 2 foals were not inherited alleles from sire or dam, and excluded by the incompatibility of 7 markers. Our result w[r]

Như vậy qua nghiên cứu chúng tôi nhận thấy Microsatellite DNA là kỹ thuật có thể ứng dụng trong mọi trường hợp chẩn đoán trước sinh khi thai phụ được xác định là người lành mang gen độ[r]

Loạn dưỡng cơ Duchenne là bệnh lý di truyền thần kinh cơ hay gặp nhất trong nhóm bệnh lý loạn dưỡng cơ do đột biến gen dystrophin trên nhiễm sắc thể X. Chẩn đoán trước sinh các bà mẹ mang thai có nguy cơ sinh con bị bệnh giúp phát hiện các trường hợp thai mắc loạn dưỡng cơ Duchenne. Ứng dung kỹ thuậ[r]

Ngoài ra, trong nghiên cứu có một trường hợp không xác định được đột biến chỉ điểm ở thai phụ và người bệnh DMD và kỹ thuật Microsatellite DNA là kỹ thuật duy nh[r]

Mục đích của luận án nhằm Chẩn đoán trước sinh bệnh loạn dưỡng cơ Duchenne cho thai nhi của những bà mẹ là người lành mang gen bệnh loạn dưỡng cơ Duchenne bằng kỹ thuật Microsatellite DNA. Mời các bạn cùng tham khảo!

Faculty of Applied Biology, Tay Do University 2
College of Aquaculture and Fisheries, Can Tho University
Abstract. The culture of giant freshwater prawn in Mekong Delta has experienced low productivity despite rapid expansion during the past several years. In recent years, Chinese[r]

Relation between TBP and nuclear matrix attachment sites
Application of the microsatellite analysis tool developed for the needs of marker-assisted selection during analysis of long-range DNA-protein interactions proved its utility especially for work with a partly sequenced genome like th[r]

TRANG 8 CẶP MỒI PRIMER RAPD: Chiều dài ngắn 10-16 mer Ti thể, microsatellite dài 20-24 mer Nồng độ cao khụng những khụng cần thiết mà tạo ra bất lợi, vỡ quỏ thừa primer, dẫn đến sự hỡnh [r]

• Giai đoạn 4: Phân tích tính đa dạng di truyền của 21 dòng cacao bằng phần mềm Genetix dựa trên dữ liệu microsatellite với 5 cặp primer.
3.2.3.Kỹ thuật ly trích DNA
DNA của lá cacao được ly trích theo qui trình trong luận văn tốt nghiệp của Hoàng Thị Liễu, 2004, nhưng có thay đổi tốc[r]

 Dựa vào các vi vệ tinh (microsatellite)
- Xét nghiệm dấu vân tay DNA dựa trên STRs được thực hiện bằng kỹ thuật PCR, nhờ đó mà các mẫu thử dù chứa ít DNA vẫn có thể nhân lên thành nhiều bản sao giống hệt nhau
- Chính nhờ ưu điểm có thể thực hiện thử nghiệm trên mẫu nhỏ, kết quả có đ[r]

From this study, we report 9 ( CA/GT ) n microsatellite-containing quail mark- ers as new markers for chickens. Similarly, six quail markers are being reported as the first novel microsatellite markers registered for guinea fowl. The guinea fowl has been reputed to be a species with gre[r]

After performing native PAGE using amplified 50 DNA samples each, POP GENE Version 1.32 was used to calculate microsatellite variation.The average expected Nei’s genetic diversity ranged[r]

differentiated histologic appearance, the proximal colon tumors in HNPCC have a better prognosis than sporadic tumors from patients of similar age. Families with HNPCC often include individuals with multiple primary cancers; the association of colorectal cancer with either ovarian[r]

We also investigated the relationship between microsatel- lite repeat length and population variation. Since we have pre- viously shown that SSR variance is independent of popula- tion history (see the results of the ANOVA analysis), we can take di ff erences in population variability across markers[r]

• Giai đoạn 4: Phân tích tính đa dạng di truyền của 21 dòng cacao bằng phần
mềm Genetix dựa trên dữ liệu microsatellite với 5 cặp primer.
3.2.3.Kỹ thuật ly trích DNA
DNA của lá cacao được ly trích theo qui trình trong luận văn tốt nghiệp của Hoàng Thị Liễu, 2004, nhưng có thay đổi tố[r]

• Giai đoạn 4: Phân tích tính đa dạng di truyền của 21 dòng cacao bằng phần
mềm Genetix dựa trên dữ liệu microsatellite với 5 cặp primer.
3.2.3.Kỹ thuật ly trích DNA
DNA của lá cacao được ly trích theo qui trình trong luận văn tốt nghiệp của Hoàng Thị Liễu, 2004, nhưng có thay đổi tố[r]

Với dữ liệu microsatellite của 21 dòng cacao khảo sát nằm trong 6 quần thể: CT, PBC, BAL, QH, BR và KKM, chúng tôi dùng phần mềm Genetix để xử lý dữ liệu microsatellite của từng cá thể trong quần thể, từ đó mô tả được quan hệ di truyền gần hoặc xa giữa các quần thể, cũng như giữa c[r]

For the 2 microsatellites within CDKN2A Table 1Shows the sequences of microsatellite markers used in the study Primers Sequence D9S916 Forward 5’- gatgtccagttgtcccttcataa -3’ Reverse 5’-[r]

device. This particular area, focused on finding new and better ways to more closely couple the MEMS electronics and mechanical subelements, can potentially have high payoffs and should not be overlooked as an important research topic.
Lastly it is important to acknowledge that a unified ‘‘big p[r]

Keeping this in view the present study was conducted to validate a panel of 8 microsatellite markers in 10 families of Bhakerwal and Pashmina breeds so that this limita[r]