RNA POLYMERASE

113–122.51 Ohtani K (1999) Implication of transcription factor E2Fin regulation of DNA replication. Front Biosci 4, D793–D804.52 Keezer SM & Gilbert DM (2002) Sensitivity of the ori-gin decision point to specific inhibitors of cellular signal-ing and metabolism. Exp Cell Res 273, 54–64.53 Hat[r]

pable of mediating such a process, namely, an RNA-directed DNA polymerase or, asit is usually called, reverse transcriptase. All RNA tumor viruses contain such an en-zyme within their virions (viral particles). RNA viruses that replicate their RNAgenomes via a DNA intermediate are classified a[r]

polymerase δ với sự trợ giúp của PCNA. Cả hai enzyme nàyđều có khả năng đọc và sửa sai.• Polymerase : Được tìm thấy trong ti thể, chức năng chưa rõ.• Ngoài các polymerase kể trên, hệ thống tái bản ở eukaryote còncó sự tham gia của nhiều protein chuyên biệt như PCNA(Proliferating[r]

HIV-1 infection. Nature 1995, 373:123-6.30. Jacobo-Molina A, Arnold E: HIV reverse transcriptase structure-function relationships. Biochemistry 1991, 30:6351-6.31. Jeon C, Agarwal K: Fidelity of RNA polymerase II transcriptioncontrolled by elongation factor TFIIS. Proc Natl Acad Sci U S A1996[r]

5' CGCACAAACTTCAAGCAATC || :: 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC || 3' CTAACGAACTTCAAACACGC PHỤ LỤC 2 Kết quả BLAST của cặp primer 225, 226 Score E Sequences producing significant alignments: (Bits) Value gi|18253957|gb|AF414119.1|AF414119 Pineapple mealybug wilt-as 40.1 0.48[r]

Background: The RNA-dependent RNA polymerase of Influenza A virus is a determinant of viralpathogenicity and host range that is responsible for transcribing and replicating the negative sensesegmented viral genome (vRNA). Transcription produces capped and polyadenylated mRNAswhereas genome re[r]

ngừng phiên mã. Nguyên tắc điều hòa biểu hiện gene ở ProkaryoteGene điều hòa (regulator gene) đóng/ mở gene cấu trúc (structural gene).Gene điều hòa mã hóa protein kìm hãm (repressor protein).Promotor: nơi RNA polymerase tương tác để khởi sự phiên mãOperator: trình tự nằm sát cạnh hay nằm tro[r]

hợp đi kèm với sửa sai và hoàn chỉnh mạch mới sau khi mồi RNA được loại bỏ.+ Polymerase δ và polymerase ε : Có chức năng kéo dài DNA. Trong đó khả năng tổnghợp đoạn DNA dài nhất thuộc về polymerase δ với sự trợ giúp của PCNA. Cả haienzyme này đều có khả năng đọc và sửa sai.+ [r]

HIV-1 infection. Nature 1995, 373:123-6.30. Jacobo-Molina A, Arnold E: HIV reverse transcriptase structure-function relationships. Biochemistry 1991, 30:6351-6.31. Jeon C, Agarwal K: Fidelity of RNA polymerase II transcriptioncontrolled by elongation factor TFIIS. Proc Natl Acad Sci U S A1996[r]

Promoter Promoter hay vùng (gene) khởi động là trình tự DNA thiết yếu cho phép một gene có thể tiến hành phiên mã tạo mRNA. Các thành phần của Promoter  Phần lõi (Core) promoter  Vị trí khởi đầu phiên mã (TSS)  vị trí khoảng -35  Vị trí bám của RNA polymerase  RNA-polymerase I:[r]

among the 10 most common causes of death worldwideaccording to the 1997 World Health Organization report [2].Moreover, deaths from liver cancer caused by HBV infectionprobably exceed one million per year worldwide [3,4].The mature virus consists of a partially duplex, relaxedcircular genome of 3.2 k[r]

chứng minh. Zeffix là một chất ức chế cạnh tranh yếu trên DNA polymerase của tế bào người bệnh và không làm kết thúc chuỗi tổng hợp DNA của tế bào người bệnh. Zeffix không ức chế trực tiếp sự tổng hợp protein của virus, tuy nhiên việc giảm tổng hợp protein virus là hậu quả của sự ức chế tổng[r]

Email: Henju Marjuki - henju.marjuki@stjude.org; Hui-Ling Yen - hui-ling.yen@stjude.org; John Franks - john.franks@stjude.org; Robert G Webster* - robert.webster@stjude.org; Stephan Pleschka - stephan.Pleschka@mikro.bio.uni-giessen.de; Erich Hoffmann - erich.hoffmann@stjude.org* Corresponding author[r]

Những phương pháp thường được áp dụng trong SHPT Từ những năm giữa thê kỷ 19, các nhà nghiên cứu sinh học phân tử đã tìm cách tách các phân tử DNA, RNA cũng như protein và khuyếch đại (nhân dòng) những phân tử này. PCR (polymerase chain reaction) Trong các tài liệu tiếng Việt có nhiều cách dị[r]

Enzyme Pfu DNA polymerase thu nhận từ vi khuẩn Pyroccus furiosus có khả năng chịu nhiệt cao hơn, có hoạt tính 3’-5’ exonuclease.-Tth polymerase, tách chiết từ Thermus thermophilus, có khả năng phiên mã ngược khi có RNA và Mn2+, khi có DNA và Mg2+ thì enzyme này thực hiện khuếch đại DNA[r]

were counted and diluted 1:1 in RPMI medium. Gastriccancer cells N87 were counted and serially diluted from 1× 106 cells/milliliter to 1 cell/milliliter in the PBMC. TotalRNA was extracted and reverse- transcribed from 2 millili-ters of each fraction. qrtPCR for two genes of interest werethen perfor[r]

themophilus có khả năng hoạt động như một enzyme phiên mã ngược khi có mạch RNA khuôn và ion Mg++, nhưng với sự hiện diện của DNA khuôn và Mg++, Tth polymerase lại xúc tác cho phản ứng khuếch đại DNA. Primer và nhiệt độ lai Primer là chìa khóa quan trọng cho sự thành công hay thất bại của mộ[r]

Background: Acanthamoeba polyphaga mimivirus is the largest known ds-DNA virus and its 1.2Mb-genome sequence has revealed many unique features. Mimivirus occupies an independentlineage among eukaryotic viruses and its known hosts include only species from the Acanthamoebagenus. The existence of mimi[r]

C, tuỳ thuộc vào Tm của các mồi mà thời gian từ 30 -60 giây. - Giai đoạn 3: là giai đoạn kéo dài (extension), nhiệt độ đƣợc nhân lên 68-72 oC. Ở nhiệt độ này Taq-polymerase hoạt động tốt nhất để kéo dài các mạch DNA. Đoạn DNA nằm giữa 2 mồi đƣợc tổng hợp. Cứ sau 1 chu kỳ gồm 3 giai đoạn trên,[r]

sợi ADN mới của Vent ADN polymerase (trên 80 nucleotide/giây) cũng nhanh hơn so với Taq ADN polymerase (75 nucleotide/giây). Vent ADN polymerase lại ít gây lỗi khi xúc tác tổng hợp sợi ADN mới (1/31.000) so với Taq ADN polymerase (1/290 đến 1/2.400) [3, 5]. Những đột biến[r]